Questions tagged as 'unix'

Tagged questions
1
answer

How to make a process wait for the 'brothers'

Hello. I need to create a process tree, so far what I managed to do was create one side of the tree, kill everything and then create the other side. But I need to create the whole tree before and start killing the children and the father. My...
asked by 29.04.2016 / 22:54
1
answer

How to get different outputs (fasta) files with unix or python

I have a fasta file that has several gene sequences, such as: >gene1 C.irapeanum 5.8S rRNA gene CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGATGAGACCGTGGAATAAACGATCGAGTG >gene2 C.irapeanum 5.8S rRNA gene AATTTCAAGGTTTCCGTAGGTGAACCTGCGGAAGGA...
asked by 02.02.2017 / 17:32
2
answers

Convert date to Unix timestamp

I have a table in a MySQL database that has a date column VARCHAR , type 20-09-2017 and I need to migrate this column to a bigint(8) column that uses the Unix date format timestamp . How to do this?     
asked by 20.09.2017 / 14:35
1
answer

How to publish my library to a linux repository?

I've developed a C library and want to make it available to other developers. I would like this library to be installed using the apt-get command, for example: sudo apt-get install minhalib and in the code the developers woul...
asked by 23.05.2018 / 05:29
1
answer

Font Awesome appears as "blocks" in nginx under FreeBSD 10.1 [closed]

I have a site that I downloaded from CentOS to FreeBSD using rsync + mysqldump. In CentOS + Apache it worked normal on FreeBSD + nginx gave this error: Ibelieveitisrelatedtothiscodethat"converts" the \ f086 into an icon. #primary_nav #nav_app_...
asked by 16.04.2015 / 05:02
1
answer

Four different conditions using awk if (unix)

Hello I need to do an awk if command using 4 different conditions together, example of my input only for a few lines (I have an input with thousands of lines) chr17_30 1 chr1_72 0 chr1_46 2 chr1_47 -1 chr1_48 1 Output desirable c...
asked by 25.09.2015 / 14:58
1
answer

make sort of a file with multiple columns

Hello, I need to sort from my file, I have 3 columns: the first would be the chromosome (1,2,3,4,5..28, W, Z), the second would be the position on this chromosome and the last one they would be values. When I do the sort -n I have the...
asked by 14.09.2015 / 17:40
2
answers

Format columns - select specific information

Dear users, I have a large file with the following columns chr10_46938 EXON=28/28 STRAND=-1 ENSP=ENSGALP00000004070 SIFT=tolerated(0.38) chr10_46966 EXON=28/28 STRAND=-1 DOMAINS=Low_complexity_(Seg):Seg SI...
asked by 17.03.2015 / 15:14
1
answer

Forbidden 403 apache2 on Ubuntu

Well this is the error I'm having with my apache. I changed my apache directory to: /media/marcelo/Arquivos/Google Drive/localhost and this directory has 777 permission. Forbidden You don't have permission to access / on this server....
asked by 10.05.2017 / 00:36
1
answer

Date and Computer Language Shell Script

Is there a shell script function that takes the date and time (time zone) and language that are configured on the computer?     
asked by 08.12.2015 / 18:30